Ohio Approves Intelligent Design for Schools

[Checkmite]

I'm going to be a bit more specific, just to show off.

DNA consists chiefly of four nucleotides - Guanine, Cytosine, Adenine, and Thymine. Each is typically referred to by its first letter.

The DNA code is a "stencil", or type of template, for creating something called "Messenger RNA", or mRNA for short. mRNA is very similar to DNA, except instead of Thymine, it has a nucleotide called Uracil. So the "alphabet" of RNA is G,C,A, and U. Once the RNA is "forged" using the DNA's instructions, it moves from the nucleus to the cell's ribosomes, which actually produce the proteins.

A chain of RNA is something like a computer program. It contains "codons", or specific sets of instructions for specific tasks. Codons are made of 3 nucleotides. RNA strands are made up of like jillions of nucleotides, so let's invent a segment.


AGGCGAAAUGGUCCGAUCAUGGGUAUAACUAGUCCUCAUG

I just made this segment up out of thin air, but it does contain some real instructions. The first 6 letters in the sequence, AGGCGAA, are "nonsense". Even if they contain real codons, the ribosomes don't do anything because they haven't run across the START instruction codon, which is AUG. (At this point, I have to admit I had to Google for an amino acid table - sorry but I didn't memorize all this stuff ) After AUG, the ribosomes pay attention. The next codon, GUC, makes the amino acid valine. CGA makes arginine, UCA makes serine, UGG makes trytophan, GUA is valine again, and UAA is the STOP codon. All those letters after the STOP codon (CUAGUCCUC) is also "nonsense", because the ribosomes have "stopped", and will not do anything until the AUG, which tells them to start working again. A great deal, if not most, of DNA and the resultant RNA is like that...just extra code that doesn't do anything.

Now, I have no idea which particular protein that combination of amino acids makes, if in fact it makes any at all. But it's a valid example of what we talk about when we say "nonsense code".

 

[jj]

In Ohio of all places. I didn't think that was a big fundamentalist state.

Ohio has been to the right of Ghengis Kahn since forever.

Remember when the National Guard murdered people who weren't even doing anything but standing there, and the governor had the attourney general file incompetant charges in order to contrive a"not guilty" verdict so that they couldn't even be retried?

You think that was accidental he did that? I know it wasn't, he said so at the time, that does rather make the point, doesn't it?

I lived there. I moved out. The whole place isn't fundie so much as it is just right of the right.

What's sad is how the right has sold them out over and over, and they keep voting for the right. They think it was the left, somehow, that closed the mills, and they suck in this nonsense about how the Republiguns and the Shrub were trying to "protect" them with the steel embargo. Of course, now there is a steel shortage (did you know that?) because of lack of investment in new methods, and it's all the Shrub's supporters who are trying to bring the stuff over from Indonesia, except that it's cheaper to sell it closer to home... Oops. Wasn't the dummycraps that did that, it was the republiguns. (but it was the dummycraps that helped with the original shutdown with stupid labor laws that allowed the unions to originally dictate how to run the mills... So it goes...)

 

[Psi Baba]

I'm going to be a bit more specific, just to show off.

DNA consists chiefly of four nucleotides - Guanine, Cytosine, Adenine, and Thymine. Each is typically referred to by its first letter.

The DNA code is a "stencil", or type of template, for creating something called "Messenger RNA", or mRNA for short. mRNA is very similar to DNA, except instead of Thymine, it has a nucleotide called Uracil. So the "alphabet" of RNA is G,C,A, and U. Once the RNA is "forged" using the DNA's instructions, it moves from the nucleus to the cell's ribosomes, which actually produce the proteins.

A chain of RNA is something like a computer program. It contains "codons", or specific sets of instructions for specific tasks. Codons are made of 3 nucleotides. RNA strands are made up of like jillions of nucleotides, so let's invent a segment.


AGGCGAAAUGGUCCGAUCAUGGGUAUAACUAGUCCUCAUG

I just made this segment up out of thin air, but it does contain some real instructions. The first 6 letters in the sequence, AGGCGAA, are "nonsense". Even if they contain real codons, the ribosomes don't do anything because they haven't run across the START instruction codon, which is AUG. (At this point, I have to admit I had to Google for an amino acid table - sorry but I didn't memorize all this stuff ) After AUG, the ribosomes pay attention. The next codon, GUC, makes the amino acid valine. CGA makes arginine, UCA makes serine, UGG makes trytophan, GUA is valine again, and UAA is the STOP codon. All those letters after the STOP codon (CUAGUCCUC) is also "nonsense", because the ribosomes have "stopped", and will not do anything until the AUG, which tells them to start working again. A great deal, if not most, of DNA and the resultant RNA is like that...just extra code that doesn't do anything.

Now, I have no idea which particular protein that combination of amino acids makes, if in fact it makes any at all. But it's a valid example of what we talk about when we say "nonsense code".

Perhaps the "nonsense" code are merely the programmer's "comments" in between statements.

 

[shanek]

From the article:

The vote was applauded by the Seattle-based Discovery Institute, which supports scientists studying intelligent design theory, and says states should teach both evolution and scientific criticism of evolutionary theory.

Okay, so we'll teach evolution, and in the same class we'll also teach "scientific criticism of evolution." So, one day, the lesson will go something like this:

"And now, class, we will cover the scientific criticism of evolution."

A few seconds of silence pass.

"All right, now if there are no questions, we will now have our exam for this subject. Everyone please turn in a blank piece of paper, and you've all made 100%."

 

[pupdog]

So the ID Creationists have been very successful in gaining publicity, and getting some of their blatherskite put into school curricula. They still have not accomplished one of their primary goals, one that was supposed to be accomplished early on: getting serious research publlished in scientific, peer-reviewed professional journals. And that for the simple reason that what they do is not science.

We know (because they have said so) that this group will not stop at bringing god-as-science into schools for criticisms of evolution--there are more aspects of biology that they are uncomfortable with, not to mention other aspects of geology, even physics. Welcome back, Dark Ages!

 

[Tricky]

I'm going to be a bit more specific, just to show off.

The first 6 letters in the sequence, AGGCGAA, are "nonsense". Even if they contain real codons, the ribosomes don't do anything because they haven't run across the START instruction codon, which is AUG. After AUG, the ribosomes pay attention. The next codon, GUC, makes the amino acid valine. CGA makes arginine, UCA makes serine, UGG makes trytophan, GUA is valine again, and UAA is the STOP codon. All those letters after the STOP codon (CUAGUCCUC) is also "nonsense", because the ribosomes have "stopped", and will not do anything until the AUG, which tells them to start working again. A great deal, if not most, of DNA and the resultant RNA is like that...just extra code that doesn't do anything.

Perhapsthenonsensecodeislikethespacebetweenwords. Itdoesn'tmeananything,butkeepsthemeaningfulwordsapart. Still,sentenceswouldbeprettyhardtoreadwithoutspaces.

 

[Wrath of the Swarm]

Is this statement still general consensus?

What difference does that make? The important thing is that it's true.

There are effects on gene regulation of even "junk DNA", but a significant portion of our genome seems to be damaged, virus-written, or otherwise worthless.

 

[Zep]

Simple solution for teachers: Teach only the scientifically published, peer-reviewed and accepted ID material. As there is little to none of it, no teaching of it will be required; therefore crisis over.

Complaints from the ID camp? Get something scientifically published and then it can be added to the list of classroom materials. Just like all the other science stuff.

 

[PygmyPlaidGiraffe]

Simple solution for teachers: Teach only the scientifically published, peer-reviewed and accepted ID material. As there is little to none of it, no teaching of it will be required; therefore crisis over.

Complaints from the ID camp? Get something scientifically published and then it can be added to the list of classroom materials. Just like all the other science stuff.

hmmm, I wonder could this work? is there a precedent for this?which school district/ jurisdiction? Its an intriguing idea. Would there be any reason why this approach's standard of scientifically published peer reviewed work could be rejected by a schoolboard or by the courts?

 

[Thanz]

Firstly, in response to Brown and Joshua Korosi, I think that it is somewhat arrogant to think that we, as humans, have it all figured out and therefore certain parts of DNA are useless, etc. If there is one thing that the history of science shows us it is that we have never had it all figured out.

Next, I think you need to step back a little bit and realize what the ID vs. Evolution debate really is. It is not focussed solely on humans, but rather on liffe on earth as a whole. Pointing to things that you perceive as incorrect with the human design is not proof of no designer. Rather, it shows your bias in wanting a design that has humans living as long as possible, which may not be good in the grand scheme of things.

Last, I think that there is one aspect of ID that should be examined in a science class, and it is the one that is really the core of those who see ID as science: irreducible complexity. As I understand it, ID as science advocates point to things such as the eye and claim that it could not have evolved naturally, and must have been designed. This seems to me to be a claim that is ripe for a scientific analysis.

 

[Brown]

Last, I think that there is one aspect of ID that should be examined in a science class, and it is the one that is really the core of those who see ID as science: irreducible complexity. As I understand it, ID as science advocates point to things such as the eye and claim that it could not have evolved naturally, and must have been designed. This seems to me to be a claim that is ripe for a scientific analysis.

The concept of "irreducible complexity" is a hard one to discuss scientifically, because it does not seem to be defined. Take the human eye. If it were "designed" for people, then the designer did not do the best job that he could. Lots of animals have eyesight that is better than ours, by almost any standard you care to name.

In addition, lots of animals have eyesight that is worse than ours, too. Some animals have eyes that resolve objects less well, some of them have eyes that omit structures present in our eyes, and some of them merely detect light and dark. At what point does the "irreducible complexity" kick in? The ID folks tend to be vague on this point.

The subject can be a good one for scientific analysis. One could generate a continuum of light-sensitive organs in the animal kindgom and try to point out which of them is the simplest and cannot be made simpler. If one cannot identify such a point, what does that say about "irreducible complexity?" What does it suggest about natural selection?

 

[sickstan]

ohio sucks

Mostly. Port Clinton has some good walleye fishing sometimes. Otherwise, I agree with you.

 

[Thanz]

The subject can be a good one for scientific analysis. One could generate a continuum of light-sensitive organs in the animal kindgom and try to point out which of them is the simplest and cannot be made simpler. If one cannot identify such a point, what does that say about "irreducible complexity?" What does it suggest about natural selection?

This sounds like an excellent way to show to students what the differences really are. If irreducible complexity is a real phenomena, there must be some bottom point. If you can't point to it, is it real? It is my understanding that a lot of these "ID" curriculum laws monkey with what is evidence and what isn't. If you cannot point to the "this simple, no simpler" point for something like the eye, it would seem to me that ID doesn't meet the evidentiary hurdles that its proponents are trying to throw in the way of evolution.

 

[Brian the Snail]

Last, I think that there is one aspect of ID that should be examined in a science class, and it is the one that is really the core of those who see ID as science: irreducible complexity. As I understand it, ID as science advocates point to things such as the eye and claim that it could not have evolved naturally, and must have been designed. This seems to me to be a claim that is ripe for a scientific analysis.

The point is that irreducibly complex systems can evolve naturally. This site gives three possible mechanisms by which this can occur: 1) reduction of function, 2) loss of scaffolding, 3) duplication. This has been known about, and studied for decades.

 

[BillyTK]

Gee, I wonder if they will allow equal time for my class lesson, "Unintelligent Design." The idea behind UD is that there was a designer of some sort, but far from being wise, he was a fool, a bumbler or a sadist. Or perhaps all three. Consider the evidence:

[...]

Sounds like Libertarianism to me. The free-market designer would do a far more efficient job.

 

[Thanz]

The point is that irreducibly complex systems can evolve naturally. This site gives three possible mechanisms by which this can occur: 1) reduction of function, 2) loss of scaffolding, 3) duplication. This has been known about, and studied for decades.

Great! My point was simply that this should be taught. I didn't think that I was breaking any new ground in suggesting that irreducible complexity should be examined scientifically - just that it is an appropriate topic in a science classroom. I agree with most of the people on this board who say that "God did it" is not an appropriate topic for a science classroom.

Really, all I was saying is that there are parts of ID that can be examined in a science classroom that will actually enhance the science understanding of the students.

 

[Michael Redman]

The problem is that the fundies have been successful in spreading the idea that evolution is a belief scientists hold for personal reasons, and not the result of scientific inquiry, and constantly subjected to review and challenge.

 

[Brian the Snail]

Great! My point was simply that this should be taught. I didn't think that I was breaking any new ground in suggesting that irreducible complexity should be examined scientifically - just that it is an appropriate topic in a science classroom. I agree with most of the people on this board who say that "God did it" is not an appropriate topic for a science classroom.

Really, all I was saying is that there are parts of ID that can be examined in a science classroom that will actually enhance the science understanding of the students.

Sorry, I misunderstood your point. Now that you've clarified it, I'm actually inclined to agree with you. If the idea of intelligent design is itself put under scrutiny then I think that could make for a very good area of study. As well as helping understanding, perhaps students will be less inclined to believe it.

I guess my worry would be that this won't happen, and that instead it will just be bashing evolution, with ID presented as an alternative "theory" without any critical analysis of it. Certainly, the report in the OP seemed to imply that this was the case.

 

[Thanz]

Sorry, I misunderstood your point. Now that you've clarified it, I'm actually inclined to agree with you. If the idea of intelligent design is itself put under scrutiny then I think that could make for a very good area of study. As well as helping understanding, perhaps students will be less inclined to believe it.

Not your fault. I should have expressed myself in a clearer fashion to begin with.

I guess my worry would be that this won't happen, and that instead it will just be bashing evolution, with ID presented as an alternative "theory" without any critical analysis of it. Certainly, the report in the OP seemed to imply that this was the case.

Unfortunately, I think you are correct. People are pushing to get ID in the classrom in order to distract from evolution. I am just hopeful that science teachers can use the mandated ID curriculum to actually show that evolution has way more scientific support than ID, even with the qualifiers on what they can say about evidence, etc.

I hope that it is easy to say that evolution has X evidence, and there may be some problems with things like carbon dating, but it is the best we've got. On the other hand, ID has.... well, no actual evidence, but it kinda sounds neat, doesn't it? and then let the students decide which is scientific. We should be teaching our kids the ability to see the differences between these two on their own.

 

[shanek]

Sounds like Libertarianism to me. The free-market designer would do a far more efficient job.

Y'know, it's amazing how people make unwarranted cracks like this in irrelevant threads and then get all indignant when I accuse them of bias...