Annoying creationists

[kjkent1]

If setting ev mistake weights to zero proves that evolution is sped up by the absence of competing selective pressure (and slowed by the introduction of competing selective pressure), then the natural extension of this is that zero mistake weights for all selective pressures should increase the speed of evolution to the maximum.

And, ev does indeed prove this, because with all mistake weights set to zero, ev generates a perfect creature in the first generation every time, regardless of the genome length.

Which proves abiogenesis -- and falsifies the existence of a divine creator.

That's right folks. Kleinman demonstrates that, based on ev, any and all random genomes instantly produce viable life forms without selection!

Absolutely amazing logic.

 

[Paul C. Anagnostopoulos]

That's right folks. Kleinman demonstrates that, based on ev, any and all random genomes instantly produce viable life forms without selection!

And the really cool part is that it's all based on the interpretation of the word perfect. Now who made up the term perfect creature? Why, yours truly. By a mere flick of the terminology wrist, I have solved the problem of abiogenesis and discovered the core concept of evolution: Abiogenesis and evolution are instantaneous; everything else just slows them down. I'll let y'all know when the Nobel committee contacts me.

~~ Paul

 

[delphi_ote]

Too bad your point is not supported by the results from ev or the example of using three selection pressures to treat HIV. Both the theoretical and real examples show that three non-fatal selection pressures profoundly slow the rate of evolution.

Both results support my claim. You just haven't bothered to understand the fitness landscape concept. I'll give you a link where you can read about it in plain English. Click on these words.

 

[Ichneumonwasp]

If the causative factor does not affect reproduction, then it is not a selection pressure. It doesn’t matter whether the causative factor affects reproduction directly or indirectly for it to be a selection pressure. An environmental temperature change does not need to directly effect the temperature of a bird’s egg in order to affect the ability of the bird to reproduce.

That is not the point I was making. If you had read what I wrote you would not respond in this way. The point I made concerned a directed (man-made, directed) and direct attack on the ability to reproduce a virus. If the machinery for viral reproduction is completely shut off, then there is no possibility for reproduction and fitness drops to zero. End of story. If an indirect attack affects fitness it can serve as a pressure but not leave fitness at zero. Those are different scenarios.

The number of selection pressures is not necessarily the important factor that translates to a fitness of zero. A single pressure can translate into a fitness of zero.

If you think that multiple selection pressures can speed up evolution, give us some examples.

This is now the third time that I must tell you that I am not playing that game.

So, let's get this out of the way. I'm not playing that game. I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.

Got it? We are discussing your analogy. Once we finish with your analogy we can move on.

Again, give us examples of multiple selection pressures that speed up evolution. Give us an example of the selection pressure that would evolve a gene from the beginning.

Hello? Hello? Are you not even capable of sticking to the topic at hand? Hello? Hello?

Your analogy. That is what we are discussing. Nothing else. I asked a simple question about the use of this analogy and you responded. We are discussing your analogy. Your analogy. I'm hoping it will stick in your mind if I repeat it enough.

No evolutionist will play that game because there are no selection pressures that evolve a gene from the beginning.

Um, gosh, and all this time I thought it was because we started along a certain line of argument, and I didn't want any distractions from that line of argument. So, really, I have ulterior motives? That's nice. What am I having for lunch since you know so much about me and my motives?

Once and for all -- we are discussing your analogy. Stick to the topic at hand. No obfuscation.

The issue at hand is the mathematics of mutation and selection.

Not with me it isn't. You can argue whatever you want with other people. I asked a simple question. You returned with a snarky comment and have continued in the same vein. We -- you and I -- are discussing your use of a metaphor. Nothing else.

You affect evolution by reducing the fitness of the creature. That fitness is measured by the ability of the creature to reproduce. The virus always wins? No viruses go extinct?

Please pay attention. We are discussing HIV, not any virus. I have made no claims about any other virus or any other organism. I have used other analogies to make my points.

The use of triple antiviral medications to treat HIV is a very nice example of how mutation and selection works. I’m simply playing the evolutionist game by the evolutionist rules. The evolutionist computer model ev shows mathematically the same results as the real example of the treatment of HIV. These examples also show why multiple selection pressures slow evolution.

Of course it is a nice example of how certain types of selection pressures and mutation works. That is not the issue. The issue is that you made a very specific claim about it -- that it represents three selection pressures. I assume that you mean an actual three, as in not two and not four or more. That claim is wrong. There are many more than three selection pressures at work. And that particular selection pressure is very specific and not like the typical selection pressures one sees in nature or, again, I would assume are modelled in ev. That's all I'm saying. I'm saying your analogy is poor.

Extinction does not lead to evolution, extinction is the end of a genetic line

Whoa, extinction is the end of the line? Really?

Give me a break. This is not first grade. Please stop preteding that no one knows what words mean but you.

Evolution is not a process affecting a single entity or one species. Last time I checked, there was a great big world out there with numerous competing species, competing individuals. They change over time. That is evolution. It is simply stupid to say that evolution ends when one species dies. Evolution doesn't end. It isn't slowed. It continues. Certain pressures lead to extinction. Fact.

The reason you have no idea what I’m talking about is that you don’t understand the mathematics of ev.

I have a very good idea what you are talking about. You are simply wrong. Your metaphor is wrong.

Do you still want to defend this metaphor?

If parasites kill their host before they can complete their life cycle then they will go extinct. Syphilis is no longer an absolute scourge because of the advent of antibiotics, also the selective pressure on the host has selected out those who can’t mount a strong immune response against the bacteria.

Good, so you now agree that early host death is a selection pressure on a parasite? If you haven't bothered reading the literature on syphilis I suggest you do so. The spirochete became less virulent long before the use of antibiotics. Or do you want to deny this reality as well?

Any of the selection pressures you allege are so weak that the sum of all pressures have no affect on the outcome of the disease when compared to the affect of triple antiviral therapy.

What difference does that make? You can't model weak selection pressures? The whole point is that if you give an organism a selection pressure or pressures that they cannot overcome, then they will become extinct. Nothing magical there. It isn't the number that matters. It is the type of pressure. If you haven't noticed that is what I have been going on about for these several posts that are becoming increasingly boring and repetitious.

You are making a distinction where none exists. A selection pressure by definition is one which affects the ability of a creature to reproduce. Ultimately, all these pressures act somewhere at the genetic level. Whether the pressure acts directly on enzymes involved in reproduction of the genome or at some other metabolic step which is required for the creature to survive, they all affect the fitness of a creature to reproduce. If you starve a creature, you deprive the creature of the required energy and materials needed to reproduce. This is an example of multiple selection pressures. If you deprive a creature of a single essential nutrient, you impair the reproduction of that creature with a single selection pressure.

You continue to focus on the wrong issue. No one claims that the site (molecular vs organism as a whole) of the selection pressure is the absolute critical entity. The point is that a selection pressure that directly affects fitness and will not allow any reproduction is different from a relative pressure that still allows some reproduction. The number of factors is not critical. The critical issue is how effective the pressure is in preventing reproduction. Strong effect -- big effect on fitness. Weak effect -- weak effect on fitness. Completely stop reproduction and the organism will go extinct. But that is not the reality of most selection pressures in the wild (except, of course, for the rally big ones that do cause extinction). Most selection pressures are relatively weak. They affect fitness but do not generally completely stop reproduction. Even when they are present in large numbers, as you seem to agree is the case with the very large number of selection pressures affecting HIV. You did agree above that there are many selection pressures affecting HIV did you not?

As I said previously to Delphi, there is nothing special about three selection pressures other than it only takes three selection pressures to profoundly slow evolution.

Where is your evidence? It cannot be HIV. HIV has many more than three selection pressures. You have already admitted that most of those selection pressures are rather weak. Good, we agree. That is my point. Three selection pressures do not profoundly slow evolution. There is nothing special about the number three in slowing evolution (again, whatever that phrase means).

There can very easily be something special about certain types of pressures that slow the process of change in a particular organism because that (or those) pressure(s) significantly hit fitness for that organism. But that is the critical issue -- the particular effect on fitness of the pressure involved. There could be several hundred weak selection pressures that help to create changes in organisms. That is, in fact, what I would expect from nature.

You can say that three selection pressures profoundly slow evolution. But you would be wrong. That statement must be qualified. It is not the case that the number three is in any way important. It is the types of pressures that matter.

ETA

Or, to make the point again, we seem to have identifed hundreds, if not thousands, of selection pressures working on HIV -- all of which existed before the introduction of triple therapy -- during which time the virus was reproducing and mutating into many different forms. So, it cannot be the case that three selection pressures (or an increasing number of selection pressures) necessarily profoundly slows "evolution". Once again, it is not the number, but the type of selection pressure that is critical.

 

[delphi_ote]

Now who made up the term perfect creature?

Definition:

 

[kleinman]

Annoying Creationists

That's right folks. Kleinman demonstrates that, based on ev, any and all random genomes instantly produce viable life forms without selection!

And the really cool part is that it's all based on the interpretation of the word perfect. Now who made up the term perfect creature? Why, yours truly. By a mere flick of the terminology wrist, I have solved the problem of abiogenesis and discovered the core concept of evolution: Abiogenesis and evolution are instantaneous; everything else just slows them down. I'll let y'all know when the Nobel committee contacts me.

Paul, you seem to be right at home in one of kjkent1’s 10^500 alternative universes.

Too bad your point is not supported by the results from ev or the example of using three selection pressures to treat HIV. Both the theoretical and real examples show that three non-fatal selection pressures profoundly slow the rate of evolution.

Both results support my claim. You just haven't bothered to understand the fitness landscape concept. I'll give you a link where you can read about it in plain English.

Click on these words.

I did click on these words and here are some of them:

Fitness landscapes are often conceived of as ranges of mountains. There exist local peaks (points from which all paths are downhill, i.e. to lower fitness) and valleys (regions from which most paths lead uphill). A fitness landscape with many local peaks surrounded by deep valleys is called rugged.

Apart from the field of evolutionary biology, the concept of a fitness landscape has also gained importance in evolutionary optimization methods such as genetic algorithms or evolutionary strategies. In evolutionary optimization, one tries to solve real-world problems (e.g., engineering or logistics problems) by imitating the dynamics of biological evolution. For example, a delivery truck with a number of destination addresses can take a large variety of different routes, but only very few will result in a short driving time. In order to use evolutionary optimization, one has to define for every possible solution s to the problem of interest (i.e., every possible route in the case of the delivery truck) how 'good' it is. This is done by introducing a scalar-valued function f(s) (scalar valued means that f(s) is a simple number, such as 0.3, while s can be a more complicated object, for example a list of destination addresses in the case of the delivery truck), which is called the fitness function or fitness landscape. A high f(s) implies that s is a good solution. In the case of the delivery truck, f(s) could be the number of deliveries per hour on route s. The best, or at least a very good, solution is then found in the following way. Initially, a population of random solutions is created. Then, the solutions are mutated and selected for those with higher fitness, until a satisfying solution has been found.

Evolutionary optimization techniques are particularly useful in situations in which it is easy to determine the quality of a single solution, but hard to go through all possible solutions one by one (it is easy to determine the driving time for a particular route of the delivery truck, but it is almost impossible to check all possible routes once the number of destinations grows to more than a handful).

What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

Delphi, not only does your link to Wikipedia fitness landscape not support your claims, it explains in evolutionist terms what ev is showing. That is, multiple selection conditions are almost impossible to evolve. Thank you for this reference, I think I will co-opt it for my proof that the theory of evolution is mathematically impossible.

If the causative factor does not affect reproduction, then it is not a selection pressure. It doesn’t matter whether the causative factor affects reproduction directly or indirectly for it to be a selection pressure. An environmental temperature change does not need to directly effect the temperature of a bird’s egg in order to affect the ability of the bird to reproduce.

That is not the point I was making. If you had read what I wrote you would not respond in this way. The point I made concerned a directed (man-made, directed) and direct attack on the ability to reproduce a virus. If the machinery for viral reproduction is completely shut off, then there is no possibility for reproduction and fitness drops to zero. End of story. If an indirect attack affects fitness it can serve as a pressure but not leave fitness at zero. Those are different scenarios.

The number of selection pressures is not necessarily the important factor that translates to a fitness of zero. A single pressure can translate into a fitness of zero.

Read Delphi’s link to Wikipedia and fitness landscape. It doesn’t matter whether the selection pressures are man-made or from environmental sources. The mathematics is identical.

If you think that multiple selection pressures can speed up evolution, give us some examples.

This is now the third time that I must tell you that I am not playing that game.

So, let's get this out of the way. I'm not playing that game. I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.I'm not playing that game.

Got it? We are discussing your analogy. Once we finish with your analogy we can move on.

Of course you are not going to play this game. Evolutionists already know that multiple selection pressures slow evolution. The treatment of HIV with three selective pressures slows the evolution of the virus. This is what ev shows and this is what the Wikipedia definition for fitness landscape shows.

Again, give us examples of multiple selection pressures that speed up evolution. Give us an example of the selection pressure that would evolve a gene from the beginning.

Hello? Hello? Are you not even capable of sticking to the topic at hand? Hello? Hello?

Your analogy. That is what we are discussing. Nothing else. I asked a simple question about the use of this analogy and you responded. We are discussing your analogy. Your analogy. I'm hoping it will stick in your mind if I repeat it enough.

Well tell us, do you believe multiple selection pressures speed up or slow down evolution? Ev shows that multiple selection pressures slow down evolution, The Wikipedia definition for fitness landscape shows that multiple selection pressures slow down evolution and the use of triple selection pressures on HIV shows that multiple selection pressures slow down evolution.

No evolutionist will play that game because there are no selection pressures that evolve a gene from the beginning.

Um, gosh, and all this time I thought it was because we started along a certain line of argument, and I didn't want any distractions from that line of argument. So, really, I have ulterior motives? That's nice. What am I having for lunch since you know so much about me and my motives?

Once and for all -- we are discussing your analogy. Stick to the topic at hand. No obfuscation.

Ichneumonwasp, I do not obfuscate, I annoy evolutionists.

The issue at hand is the mathematics of mutation and selection.

Not with me it isn't. You can argue whatever you want with other people. I asked a simple question. You returned with a snarky comment and have continued in the same vein. We -- you and I -- are discussing your use of a metaphor. Nothing else.

Of course evolutionists do not want to talk about the mathematics of mutation and selection, it shows your theory to be impossible.

You affect evolution by reducing the fitness of the creature. That fitness is measured by the ability of the creature to reproduce. The virus always wins? No viruses go extinct?

Please pay attention. We are discussing HIV, not any virus. I have made no claims about any other virus or any other organism. I have used other analogies to make my points.

Oh yes, that’s right, we are talking about the evolution of the HIV virus. That example shows that triple selection pressures slow down the evolution of the virus.

The use of triple antiviral medications to treat HIV is a very nice example of how mutation and selection works. I’m simply playing the evolutionist game by the evolutionist rules. The evolutionist computer model ev shows mathematically the same results as the real example of the treatment of HIV. These examples also show why multiple selection pressures slow evolution.

Of course it is a nice example of how certain types of selection pressures and mutation works. That is not the issue. The issue is that you made a very specific claim about it -- that it represents three selection pressures. I assume that you mean an actual three, as in not two and not four or more. That claim is wrong. There are many more than three selection pressures at work. And that particular selection pressure is very specific and not like the typical selection pressures one sees in nature or, again, I would assume are modelled in ev. That's all I'm saying. I'm saying your analogy is poor.

Oh, that’s right, our Sesame Street drop out, Dr Richard, says there are thousands of selection pressures acting on HIV. I wonder if he would care to describe the fitness landscape mathematically. Then Paul could mathematically model the evolution of the HIV virus from the beginning.

Extinction does not lead to evolution, extinction is the end of a genetic line

Whoa, extinction is the end of the line? Really?

Give me a break. This is not first grade. Please stop preteding that no one knows what words mean but you.

Evolution is not a process affecting a single entity or one species. Last time I checked, there was a great big world out there with numerous competing species, competing individuals. They change over time. That is evolution. It is simply stupid to say that evolution ends when one species dies. Evolution doesn't end. It isn't slowed. It continues. Certain pressures lead to extinction. Fact.

Extinction represents the loss of genetic information.

The reason you have no idea what I’m talking about is that you don’t understand the mathematics of ev.

I have a very good idea what you are talking about. You are simply wrong. Your metaphor is wrong.

Do you still want to defend this metaphor?

Certainly I will continue to defend this metaphor. Delphi has helped me with this defense when he gave the link to Wikipedia fitness landscape.

If parasites kill their host before they can complete their life cycle then they will go extinct. Syphilis is no longer an absolute scourge because of the advent of antibiotics, also the selective pressure on the host has selected out those who can’t mount a strong immune response against the bacteria.

Good, so you now agree that early host death is a selection pressure on a parasite? If you haven't bothered reading the literature on syphilis I suggest you do so. The spirochete became less virulent long before the use of antibiotics. Or do you want to deny this reality as well?

Really? What was the most common cause for aortic arch aneurysm before the use of antibiotics? Untreated syphilis is still a profoundly destructive disease.

Any of the selection pressures you allege are so weak that the sum of all pressures have no affect on the outcome of the disease when compared to the affect of triple antiviral therapy.

What difference does that make? You can't model weak selection pressures? The whole point is that if you give an organism a selection pressure or pressures that they cannot overcome, then they will become extinct. Nothing magical there. It isn't the number that matters. It is the type of pressure. If you haven't noticed that is what I have been going on about for these several posts that are becoming increasingly boring and repetitious.

If your alleged selection pressures have no affect on reproduction then they have no effect on evolution. You need to learn the basics of your own theory.

You are making a distinction where none exists. A selection pressure by definition is one which affects the ability of a creature to reproduce. Ultimately, all these pressures act somewhere at the genetic level. Whether the pressure acts directly on enzymes involved in reproduction of the genome or at some other metabolic step which is required for the creature to survive, they all affect the fitness of a creature to reproduce. If you starve a creature, you deprive the creature of the required energy and materials needed to reproduce. This is an example of multiple selection pressures. If you deprive a creature of a single essential nutrient, you impair the reproduction of that creature with a single selection pressure.

You continue to focus on the wrong issue. No one claims that the site (molecular vs organism as a whole) of the selection pressure is the absolute critical entity. The point is that a selection pressure that directly affects fitness and will not allow any reproduction is different from a relative pressure that still allows some reproduction. The number of factors is not critical. The critical issue is how effective the pressure is in preventing reproduction. Strong effect -- big effect on fitness. Weak effect -- weak effect on fitness. Completely stop reproduction and the organism will go extinct. But that is not the reality of most selection pressures in the wild (except, of course, for the rally big ones that do cause extinction). Most selection pressures are relatively weak. They affect fitness but do not generally completely stop reproduction. Even when they are present in large numbers, as you seem to agree is the case with the very large number of selection pressures affecting HIV. You did agree above that there are many selection pressures affecting HIV did you not?

Ev’s selection conditions don’t allow for extinction and shows how slow the evolutionary process is with only three selection conditions. If a selection condition is so weak to have little effect on reproduction, it will have little effect on evolution. The mathematical point is that selection increases the frequency of sequences of bases in the population. The mathematical conundrum that evolutionist have to face is that multiple selection pressures confound this process.

As I said previously to Delphi, there is nothing special about three selection pressures other than it only takes three selection pressures to profoundly slow evolution.

Where is your evidence? It cannot be HIV. HIV has many more than three selection pressures. You have already admitted that most of those selection pressures are rather weak. Good, we agree. That is my point. Three selection pressures do not profoundly slow evolution. There is nothing special about the number three in slowing evolution (again, whatever that phrase means).

Ev shows that three selection conditions profoundly slow evolution. The treatment strategy for HIV using three selection pressures slow the evolutionary process and now Delphi has given us the Wikipedia definition for fitness landscape which shows that multiple selection conditions slow evolution.

If you think that multiple selection conditions speed up evolution, give us some mathematical proof or a physical example of your contention. I have given you both for my contention.

There can very easily be something special about certain types of pressures that slow the process of change in a particular organism because that (or those) pressure(s) significantly hit fitness for that organism. But that is the critical issue -- the particular effect on fitness of the pressure involved. There could be several hundred weak selection pressures that help to create changes in organisms. That is, in fact, what I would expect from nature.

There is nothing special about the selection conditions used in ev. Give Paul a set of selection conditions to use in ev to speed up evolution.

You can say that three selection pressures profoundly slow evolution. But you would be wrong. That statement must be qualified. It is not the case that the number three is in any way important. It is the types of pressures that matter.

I have qualified my statement mathematically with ev, by physical example with the case of treatment of HIV by triple selection pressures and now thanks to Delphi, have the Wikipedia definition of fitness landscape. How have you qualified your position?

Or, to make the point again, we seem to have identifed hundreds, if not thousands, of selection pressures working on HIV -- all of which existed before the introduction of triple therapy -- during which time the virus was reproducing and mutating into many different forms. So, it cannot be the case that three selection pressures (or an increasing number of selection pressures) necessarily profoundly slows "evolution". Once again, it is not the number, but the type of selection pressure that is critical.

Only those pressures that affect reproduction are selection pressures. Before the advent of antiretroviral medications, the only selective pressures a person could mount against HIV was the production of immunoglobins and cell mediated immunity. There were not thousands of selective pressures mounted against the virus. Neither of these selective pressures were sufficient to impair reproduction of the virus significantly. That why the vast majority of the people with HIV died from the consequences of their disease.

 

[Ichneumonwasp]

Read Delphi’s link to Wikipedia and fitness landscape. It doesn’t matter whether the selection pressures are man-made or from environmental sources. The mathematics is identical.

For the nth figgin' time, I am not claiming that the issue is man-made vs environmental. The issue is a pressure that completely blocks any possibility of reproduction and one that does not. How many time must I repeat the same thing?

Of course you are not going to play this game. Evolutionists already know that multiple selection pressures slow evolution. The treatment of HIV with three selective pressures slows the evolution of the virus. This is what ev shows and this is what the Wikipedia definition for fitness landscape shows.

No. Please follow. I am not playing the obfuscation game. We are discussing one matter and one matter alone right now. Deal with the issue at hand. The rest can wait until after this issue is resolved.

Well tell us, do you believe multiple selection pressures speed up or slow down evolution?

I'm sorry, but are you brain-damaged or something? IS this now the twentieth time for me to tell you that I'm not playing that game. Deal with your analogy in this series of posts, nothing else. The rest waits for later.

That example shows that triple selection pressures slow down the evolution of the virus.

How? You seemed to agree up above that there were other selection pressures. Do you retract that implication? There were host selection pressures from the immune system, host selection pressures from early death once the diseae course began, selection pressures related to transcription rates and competition for transcription, etc. Those are all selection pressures. There are more than three. No slowing of evolution.

Extinction represents the loss of genetic information.

Yeah, so? And when new organisms replace the extinct species?

Really? What was the most common cause for aortic arch aneurysm before the use of antibiotics? Untreated syphilis is still a profoundly destructive disease.

Who said it wasn't? It wasn't the same disease as when it first appeared, though. It allowed the infected to survive and reproduce instead of killing them quickly. Rapid death of a host is a selective pressure on parasites. Parasites that kill quickly, like syphilis when it first appeared, tend to become less deadly over time because those variants that allow the host to survive longer can make more copies.

If your alleged selection pressures have no affect on reproduction then they have no effect on evolution. You need to learn the basics of your own theory.

They do. Rapid death of a host has a distinct effect on the reproduction ability of a parasite. As does anything that can potentially interfere with transcription when a retrovirus is at play. As can the immune response that tires to keep the retrovirus out of its target cell of choice, so that it cannot reproduce. Those are all selection pressures. They all existed before triple therapy became available.

If a selection condition is so weak to have little effect on reproduction, it will have little effect on evolution.

Thank you. Finally. So, you agree that it is not the number but the type of selection pressure that is important?

The mathematical conundrum that evolutionist have to face is that multiple selection pressures confound this process.

Wait, you just agreed that selection conditions that have little effect on reproduction will have little effect on evolution. You just said that up above. Multiple little effects does not mean one big effect, necessarily. It may slow things down a bit, but it will not stop it. I have no problem with multiple little effects slowing down the process. I don't know if it will or not. That is not my concern in this exchange. My concern is your use of this analogy.

The treatment strategy for HIV using three selection pressures slow the evolutionary process

There is nothing special about triple therapy. Three agents is a compromise between effectiveness and toxicity and nothing else. And, again, there are not three selection pressures when triple therapy is applied. There are three more selection pressures added to what already existed. And those pressures are specifically designed to stop viral replication. That is a singularly profound pressure. Nothing magical about the number three. How it relates to ev is not born out by your example of trying to use it.

How have you qualified your position?

How have I qualified my position that your analogy is inappropriate? I haven't. I think your analogy is inappropriate.

Before the advent of antiretroviral medications, the only selective pressures a person could mount against HIV was the production of immunoglobins and cell mediated immunity.

No, that is incorrect.

Neither of these selective pressures were sufficient to impair reproduction of the virus significantly.

Yes, that was part of the point. But they are still selective pressures. They were weak selective pressures, not strong pressures. No one is going to argue that many strong selective pressures will mean that organisms will thrive. The exact opposite will occur. They may go extinct. But those multiple selection pressures are just what may drive the change in this virus to something that we cannot treat. Since a percentage (small) of newly diagnosed HIV patients already show resistence to three drugs, we are in trouble. If those multiple pressures do not kill the virus or organism, they will probably cause new forms to develop, to escape the pressure. We are already starting to see this with HIV.

 

[kjkent1]

What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

Subtle goal-post move alert.

Suddenly, we need three or more selective pressures before kleinman's theory of evolutionary slow down becomes operational. I wonder why two aren't enough? And, how do we know that four pressures won't speed things up again?

We should try 6,542,301,015,743,039,873,666 selective pressures and see what that does. It could turn out to be a fundamental number (especially since I just made it up).

No, wait, I have it: "The number is 42." -- Hitchhiker's Guide to the Galaxy

 

[Ichneumonwasp]

I'm still waiting on the point of all this. I keep hearing this number three tossed about.

So far all I can see from Kleinman's argument is the trivial claim that if a lot of pressure is placed on a group of organisms, then they will not thrive. Well, of course, they won't. You'll see numbers drop and there won't be as many varieties in the soup. That can provide a bottleneck for that particular organism or species. But, that's just a trivial issue that everyone already knows.

That isn't what happens in large environments with numerous organisms who have selection pressures of several different weights. And it also does not account for breakthroughs -- while big selection pressures decrease population sizes and therefore the varieties present in any community, they do not stop evolution. Pressured organisms will either die, limp along at low population size, or produce a variety that is not subject to those selection pressures.

We simply cannot treat all selection pressures the same, or pretend that they are all equal. In the HIV example, triple therapy provides a very strong selection pressure that affects every virion (essentially). But this is not the case for all selection pressures, or even most. A wolf chasing mice will exert the exact same selection pressure on every mouse he catches -- it cannot reproduce. But it will effectively not pressure those he does not catch. The selective pressure is put onto mice in general, but it is not a universal pressure, as triple therapy is. Which is why I continue to harp on HIV as a poor example for selection pressure as it should be modelled in ev, or certainly for most situations in the wild. Triple therapy is such a strong selection pressue, not because there are three drugs, but because it can shut down viral replication. Like a wolf who ate all the mice in a region. Or a really weird wolf who only ate the gonads of all the mice in a region.

 

[Dr Adequate]

[What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

Delphi, not only does your link to Wikipedia fitness landscape not support your claims, it explains in evolutionist terms what ev is showing. That is, multiple selection conditions are almost impossible to evolve. Thank you for this reference, I think I will co-opt it for my proof that the theory of evolution is mathematically impossible.

You have entirely failed to understand the Wikipedia article you quote.

What it says is that evolutionary algorithms are particularly useful in cases where brute force optimization (checking every route) is impracticable.

Which is true, and therefore no use to you.

I don't know how you managed to turn this simple and true statement into the halfwitted gibberish you're reciting, but insofar as it's droolingly stupid and absurdly false it'll fit nicely with the rest of your bogus nonexistent "mathematical proof".

---

Heck, why am I trying to explain basic computer science to a guy too stupid to learn the forum controls?

 

[joobz]

Evolutionary optimization techniques are particularly useful in situations in which it is easy to determine the quality of a single solution, but hard to go through all possible solutions one by one (it is easy to determine the driving time for a particular route of the delivery truck, but it is almost impossible to check all possible routes once the number of destinations grows to more than a handful).

What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

New Lie # (what number is this?): Kleinman is a smart man, so I can only assume his missrepresentation of this quote is a deliberate and intentional lie.

It obviously says that it is difficult for the observer to determine the"shortest truck route" not evolution to determine the truck route. As we increase the number of variables, are ability to conceptually account for all possible effects of each variable decreases dramatically. That is why the evolutionary landscape concept is useful. It applies multi-variant optimization theory to obtain most probable successors.

This is nearly identical in concept to molecular dynamics. Most people can not possibly phathom the molecular interactions between molecules in various settings. As we add components, our ability to know a priori decreases dramatically. However, using Lennard-Jones type Potentails, You can simply step wise model F=ma over and over again for each indvidual atom in a system. Do this enough times and we can obtain a picture of the average molecule motions that can be expected in a system. We can find the minimum energy configuration for a molecule.

Another example of this type of multi-variant analysis can be seen in the clustering approach to cell signaling. "Quantitative Network Signal Combinations Downstream of TCR Activation Can Predict IL-2 Production Response."
[SIZE=-1]J Immunol. 2007 Apr 15;178(8) [/SIZE]


Again, we use math model reality. Reality has no obligation to obey our numbers. Whether it is three, two , or 42 selection pressures. If we create too harsh of a condition to survive, evolution will stop and extinction will happen. This isn't unexpected. But it isn't the number of selection pressures, but the sum effect of these barriers. Which, if you read some of Lauffenberger papers on multinodal cell signal modeling, you can see how multiple stressors may actually reduce a barrier rather than increase it.


---
Just saw that Dr. Adequate has said, much better than I, the same thing.

 

[kleinman]

Annoying Creationists

Read Delphi’s link to Wikipedia and fitness landscape. It doesn’t matter whether the selection pressures are man-made or from environmental sources. The mathematics is identical.

For the nth figgin' time, I am not claiming that the issue is man-made vs environmental. The issue is a pressure that completely blocks any possibility of reproduction and one that does not. How many time must I repeat the same thing?

Since you haven’t read the link to Wikipedia and the definition for fitness landscape, I’ll post the appropriate text.

Evolutionary optimization techniques are particularly useful in situations in which it is easy to determine the quality of a single solution, but hard to go through all possible solutions one by one (it is easy to determine the driving time for a particular route of the delivery truck, but it is almost impossible to check all possible routes once the number of destinations grows to more than a handful)

This applies to selection pressures that do not completely block reproduction.

Of course you are not going to play this game. Evolutionists already know that multiple selection pressures slow evolution. The treatment of HIV with three selective pressures slows the evolution of the virus. This is what ev shows and this is what the Wikipedia definition for fitness landscape shows.

No. Please follow. I am not playing the obfuscation game. We are discussing one matter and one matter alone right now. Deal with the issue at hand. The rest can wait until after this issue is resolved.

This is the point. Multiple selection pressures slow evolution. This is how the mathematics of mutation and selection works. Ev demonstrates this, the example of triple antiviral agents for the treatment of HIV demonstrates this.

Well tell us, do you believe multiple selection pressures speed up or slow down evolution?

I'm sorry, but are you brain-damaged or something? IS this now the twentieth time for me to tell you that I'm not playing that game. Deal with your analogy in this series of posts, nothing else. The rest waits for later.

Of course you are not playing the game, you can’t even see the goalposts. The mathematics of mutation and selection shows that multiple selection conditions slows evolution profoundly. Read Delphi’s link to fitness landscape. The use of triple antiviral agents to treat HIV is a direct application of this principle. Don’t worry, I’ll be patient with you until you understand this.

That example shows that triple selection pressures slow down the evolution of the virus.

How? You seemed to agree up above that there were other selection pressures. Do you retract that implication? There were host selection pressures from the immune system, host selection pressures from early death once the diseae course began, selection pressures related to transcription rates and competition for transcription, etc. Those are all selection pressures. There are more than three. No slowing of evolution.

I’ve already explained to you two ways in which triple antiviral slow the evolution of drug resistant strains of HIV, but since you are having a difficult time understanding this concept, I’ll repeat these points again. The first way triple antiviral agents slow the evolution of drug resistant strains of HIV is that it requires at least three mutations to occur at appropriate loci for a fully resistant strain of the virus to appear. Even if one or two mutations occur at appropriate loci, the still effective third drug will continue to slow reproduction. Slowing reproduction reduces the fitness of the virus and three drugs slow reproduction more than a single drug and delay the appearance of drug resistant strains. This is how mutation and selection works with multiple selection pressures.

Extinction represents the loss of genetic information.

Yeah, so? And when new organisms replace the extinct species?

Other species may reproduce to fill the niche left by the extinct species but you are not going to get the macroevolution of new species to fill the niche. There are no selection processes to do this and ev shows that the rate of generation of information is so profoundly slow that nothing can evolve in the time available.

Really? What was the most common cause for aortic arch aneurysm before the use of antibiotics? Untreated syphilis is still a profoundly destructive disease.

Who said it wasn't? It wasn't the same disease as when it first appeared, though. It allowed the infected to survive and reproduce instead of killing them quickly. Rapid death of a host is a selective pressure on parasites. Parasites that kill quickly, like syphilis when it first appeared, tend to become less deadly over time because those variants that allow the host to survive longer can make more copies.

You neglect the host response to disease. Populations that have never been exposed to a particular disease to not mount good host responses to the disease.

If your alleged selection pressures have no affect on reproduction then they have no effect on evolution. You need to learn the basics of your own theory.

They do. Rapid death of a host has a distinct effect on the reproduction ability of a parasite. As does anything that can potentially interfere with transcription when a retrovirus is at play. As can the immune response that tires to keep the retrovirus out of its target cell of choice, so that it cannot reproduce. Those are all selection pressures. They all existed before triple therapy became available.

The only point you make here is that ineffective selective pressures do no slow reproduction very much.

If a selection condition is so weak to have little effect on reproduction, it will have little effect on evolution.

Thank you. Finally. So, you agree that it is not the number but the type of selection pressure that is important?

When it comes to rapid extinction, the severity of the selection pressures determines the rate. What you don’t seem to understand that more than one, less severe selection pressures profoundly slows the evolutionary process. Dr Schneider’s ev model shows that the evolution of binding sites is profoundly slow when you attempt the simulation on realistic length genomes. This simulation has only three non-lethal selection conditions and the rate on information accumulation is profoundly slow, too slow to support the theory of evolution. You and Dr Richard propose that there are thousands of selection pressures on the HIV virus. The mathematics of the fitness optimization of this case is outlandishly impossible. Nothing evolves under these circumstances. That is what the ev computer model of mutation and selection shows and Dr Schneider did his mathematics correctly.

The mathematical conundrum that evolutionist have to face is that multiple selection pressures confound this process.

Wait, you just agreed that selection conditions that have little effect on reproduction will have little effect on evolution. You just said that up above. Multiple little effects does not mean one big effect, necessarily. It may slow things down a bit, but it will not stop it. I have no problem with multiple little effects slowing down the process. I don't know if it will or not. That is not my concern in this exchange. My concern is your use of this analogy.

Multiple little effects confound the evolution process, that is what ev shows, that is what Wikipedia explains when talking about fitness landscapes. Multiple little selection conditions may not cause rapid extinction but neither will anything evolve from this process. The multiple selection conditions invariably compete with one another slowing the evolutionary process for any one condition.

The treatment strategy for HIV using three selection pressures slow the evolutionary process

There is nothing special about triple therapy. Three agents is a compromise between effectiveness and toxicity and nothing else. And, again, there are not three selection pressures when triple therapy is applied. There are three more selection pressures added to what already existed. And those pressures are specifically designed to stop viral replication. That is a singularly profound pressure. Nothing magical about the number three. How it relates to ev is not born out by your example of trying to use it.

Certainly three agents is a compromise between effectiveness and toxicity. If there was no toxicity, four agents would be used and evolution slowed more so. If Paul introduced a fourth selection condition into ev, it would show evolution slowing more so than it already does with three conditions.

How have you qualified your position?

How have I qualified my position that your analogy is inappropriate? I haven't. I think your analogy is inappropriate.

The reason you think my analogy of the use of triple antiviral therapy for the treatment of HIV is inappropriate is that you have no understanding of the mathematics of mutation and selection. If you did understand the mathematics of mutation and selection, you would see the correlation. Study ev a little, it will come to you.

Before the advent of antiretroviral medications, the only selective pressures a person could mount against HIV was the production of immunoglobins and cell mediated immunity.

No, that is incorrect.

Oh, that’s right, you said the following:

Rapid death of a host is a selective pressure on parasites.

Neither of these selective pressures were sufficient to impair reproduction of the virus significantly.

Yes, that was part of the point. But they are still selective pressures. They were weak selective pressures, not strong pressures. No one is going to argue that many strong selective pressures will mean that organisms will thrive. The exact opposite will occur. They may go extinct. But those multiple selection pressures are just what may drive the change in this virus to something that we cannot treat. Since a percentage (small) of newly diagnosed HIV patients already show resistence to three drugs, we are in trouble. If those multiple pressures do not kill the virus or organism, they will probably cause new forms to develop, to escape the pressure. We are already starting to see this with HIV.

People are much more likely to have HIV resistant to three drugs if they are treated with monotherapy.

What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

Subtle goal-post move alert.

There kjkent1 goes again, a hearty meal of red herring, string cheese and whine.

I'm still waiting on the point of all this. I keep hearing this number three tossed about.

The reason three selection conditions is the number thrown around is that it is the number of selection conditions in ev. It is also the number of antiretroviral medications used to treat HIV. Both the mathematical simulation and the real case of the treatment of HIV show how three selection conditions profoundly slow evolution. I know, you and Dr Richard think there are thousands of selection pressures on HIV, however only three selection pressures (the antiretroviral medications) have significant effect on the reproduction of the virus.

Evolutionary optimization techniques are particularly useful in situations in which it is easy to determine the quality of a single solution, but hard to go through all possible solutions one by one (it is easy to determine the driving time for a particular route of the delivery truck, but it is almost impossible to check all possible routes once the number of destinations grows to more than a handful).

What ev is demonstrating that once the number of selection conditions (truck routes) becomes three or more, it becomes virtually impossible to evolve all three conditions (check all truck routes) simultaneously. When there is a single selection condition (truck route) it is easy to converge that solution (optimize that particular truck route).

New Lie # (what number is this?): Kleinman is a smart man, so I can only assume his missrepresentation of this quote is a deliberate and intentional lie.

Joobz, the James Randi resident alchemical engineer, when are you going to tell us how ribose forms nonenzymatically?

It obviously says that it is difficult for the observer to determine the"shortest truck route" not evolution to determine the truck route. As we increase the number of variables, are ability to conceptually account for all possible effects of each variable decreases dramatically. That is why the evolutionary landscape concept is useful. It applies multi-variant optimization theory to obtain most probable successors.

Really? This calls for my favorite Richard Dawkins quote:

Life isn't like that. Evolution has no long term goal

So joobz, tell us what evolution’s route is. You can do that right after you tell us how ribose forms nonezymatically. Then you can tell us what the selection pressure is that would form a gene from the beginning. Then you can tell us what the components of the DNA replicase system were doing before DNA could be replicated.

This is nearly identical in concept to molecular dynamics. Most people can not possibly phathom the molecular interactions between molecules in various settings. As we add components, our ability to know a priori decreases dramatically. However, using Lennard-Jones type Potentails, You can simply step wise model F=ma over and over again for each indvidual atom in a system. Do this enough times and we can obtain a picture of the average molecule motions that can be expected in a system. We can find the minimum energy configuration for a molecule.

That’s interesting, how many atoms do you model? Are you going to show us how abiogenesis occurs? Why don’t you show us how ribose forms nonezymatically? Feel free to use Lennard-Jones type potentials. And why don’t you apply this principle and show us the selection process that evolves a gene from the beginning?

Another example of this type of multi-variant analysis can be seen in the clustering approach to cell signaling. "Quantitative Network Signal Combinations Downstream of TCR Activation Can Predict IL-2 Production Response."

J Immunol. 2007 Apr 15;178(8)

Paul, joobz has solved your problem, all you need to do is put "Quantitative Network Signal Combinations Downstream of TCR Activation Can Predict IL-2 Production Response" into ev.

Again, we use math model reality. Reality has no obligation to obey our numbers. Whether it is three, two , or 42 selection pressures. If we create too harsh of a condition to survive, evolution will stop and extinction will happen. This isn't unexpected. But it isn't the number of selection pressures, but the sum effect of these barriers. Which, if you read some of Lauffenberger papers on multinodal cell signal modeling, you can see how multiple stressors may actually reduce a barrier rather than increase it.

Joobz, ev is showing the exact opposite of what you propose, the treatment of HIV with three antiviral medications shows the exact opposite of what you propose, Wikipedia shows the exact opposite of what you propose and your own example shows the exact opposite of what you propose when you said the following:

As we add components, our ability to know a priori decreases dramatically. However, using Lennard-Jones type Potentails, You can simply step wise model F=ma over and over again for each indvidual atom in a system.

The more complex a system gets the slower the sorting process becomes. This is a mathematical fact of life you evolutionists are in denial of. This is why the theory of evolution is mathematically impossible, that and you have no selection process that can evolve a gene from the beginning. The only science in abiogenesis is science fiction. The only problem I have with these two concepts is which one is dumb and which one is dumber.

 

[delphi_ote]

I see it so clearly now. Three selection pressures.

Mathematically proven. Praise Almighty God! Kleinman has shown me The Light!

ETA I was going to post something productive, but I realized there's no way to explain fitness landscapes any simpler than the Wikipedia entry did. I gave Kleinman the proper vocabulary to discuss the very subject he's been ranting about for pages. The fact that it didn't alter the torret of text he dumped on us one bit was pretty demoralizing. Spouting BS about the magic limit of three selection pressures is annoying enough. The least he could do is pretend to spout it coherently.

 

[kjkent1]

There kjkent1 goes again, a hearty meal of red herring, string cheese and whine.

I suppose that when a person has no counterargument, and lacks the intellectual courage to admit when he/she is wrong, that the expected response is ad hominem.

 

[Mercutio]

Sooo...wait... If each selection pressure is a truck route, and the more routes there are, the less likely we are to take any given one of them... if we increase the number of routes to the point where there are an infinite number of them, then the odds of taking any particular route are a priori 1/infinity, or zero? And this proves that the more ways around the Maginot Line, the safer the French were?

 

[kleinman]

Annoying Creationists

I see it so clearly now. Three selection pressures.

Delphi, there is only one selection pressure in this case.

ETA I was going to post something productive, but I realized there's no way to explain fitness landscapes any simpler than the Wikipedia entry did. I gave Kleinman the proper vocabulary to discuss the very subject he's been ranting about for pages. The fact that it didn't alter the torret of text he dumped on us one bit was pretty demoralizing. Spouting BS about the magic limit of three selection pressures is annoying enough. The least he could do is pretend to spout it coherently.

Simple enough Delphi, give us an example of multiple selection conditions that converges more quickly than a single selection condition. I expect to see that example about the same time you post the selection process that would evolve a gene from the beginning.

You are the one spouting about the magic limit of three selection pressures. All I have said is that the more selection pressures the slower evolution proceeds. It is ev which shows that three selection pressures are sufficient to make evolution proceed at a profoundly slow rate. It is also the example of triple antiviral therapy for the treatment of HIV which again shows that evolution can be markedly slowed.

Your challenge is simple Delphi, define three selection conditions that can evolve rapidly. I don’t think you or any other evolutionist can do this. The only BS in this thread is the theory of evolution and of course abiogenesis, the dumb and dumber of the field of biology.

There kjkent1 goes again, a hearty meal of red herring, string cheese and whine.

I suppose that when a person has no counterargument, and lacks the intellectual courage to admit when he/she is wrong, that the expected response is ad hominem.

Who can argue against red herring, string cheese and whine? It is a meal fit for a little gator.

Sooo...wait... If each selection pressure is a truck route, and the more routes there are, the less likely we are to take any given one of them... if we increase the number of routes to the point where there are an infinite number of them, then the odds of taking any particular route are a priori 1/infinity, or zero? And this proves that the more ways around the Maginot Line, the safer the French were?

Mercutio, is this your example of French whine?

 

[delphi_ote]

... the odds of taking any particular route are a priori 1/infinity, or zero?

[latex]$\frac{1}{0}\neq \infty[/latex]

[latex]$\lim_{x \rightarrow 0} \frac{1}{x} = \infty[/latex]

Bad Mercutio!

 

[delphi_ote]

Simple enough Delphi, give us an example of multiple selection conditions that converges more quickly than a single selection condition.

Multiple selection conditions (three, just for you!):

int computeFitness(String DNA) {
   fitness=0;
   if(DNA[0]==A) fitness++;
   if(DNA[1]==T) fitness++;
   if(DNA[2]==C) fitness++;
   return fitness;
}

Single selection condition:

int computeFitness(String DNA) {
   fitness=0;
   if(DNA.equals("ATCGATCGATCGATCGATCGATCGATCG")) fitness++;
   return fitness;
}

 

[Dr Adequate]

Since you haven’t read the link to Wikipedia and the definition for fitness landscape, I’ll post the appropriate text.

The first time you did it, it was a stupid halfwitted blunder.

Now it's a lie.

You may be crazy and stupid enough to think that a mere three routes would present a challenge to an evolutionary algorithm, when they can cope with millions.

But a mathematician has just explained the facts to you.

It's not a blunder any more, it's a stupid lie, you stupid liar.

 

[Dr Adequate]

Who can argue against red herring, string cheese and whine? It is a meal fit for a little gator.

More schizophrenic word salad.

(1) Is he insane?

(2) Should I feel sorry for him?